Annotation for gene MC_14291 Login  |  Sitemap

 
Green fields are editable (Login)  Hide Audits

Locus
MC_14291   (Last updated by bvalent on 2011-05-09 09:01:58.067884)   Entrez Gene Link
Chromosome/Linkage
Group
IV
Gene Symbol
Synonyms
Gene Description
MC_14291 - beta-lactamase family protein (2062 nt)
MC_14291 - beta-lactamase family protein (2062 nt)2011-05-09 09:01:58bvalentUncurated
MC_14291 - beta-lactamase family protein (2062 nt)2008-11-18 15:47:10MGOS AdminUncurated
MC_14291 - beta-lactamase family protein (2062 nt)2008-07-28 11:04:18Anupreet KourUncurated
Gene Comments
Unpublished mutant data from the Terauchi Lab showed no phenotype.
Unpublished mutant data from the Terauchi Lab showed no phenotype.2011-05-09 09:01:58bvalentUncurated
Location
Secreted Protein
No
Transcripts
IV:2557468..2559529 - (2559001..2559529, 2558457..2558727, 2557468..2558356)
2557468..2558356, 2559001..2559529, 2558457..2558727
2008-07-28 11:04:18Anupreet KourUncurated
Overlapping Features
Interpro
InterPro IDInterPro NameProgramProgram IDMatch Location
IPR001466Beta-lactamaseHMMPfamPF0014454-381
Evidence
BROAD: MGG_14291 - beta-lactamase family protein (2062 nt)
Interaction Terms
Gene Ontology Terms
Fungal Anatomy Terms
Publications
Terauchi, Ryohei et al.
Unpublished mutant data
. 2008 Nov;():.
Terauchi, Ryohei et al.
Unpublished mutant data
. 2008 Nov;():.
2008-11-17 23:46:40MGOS AdminUncurated
Mutants
KY25:Ina72pSfinx code:Mg166; EcoTILLING code:RU957Conidiation: Normal
2008-11-17 17:08:14MGOS AdminUncurated
KY25:Ina72pSfinx code:Mg166; EcoTILLING code:RU957Conidiation: Normal
Conidial germination: Normal
Appressorium Formation: Normal
Appressorial Penetration: Normal
Invasive growth: Normal
Pathogenicity: Normal pathogenecity
2008-11-18 00:34:34MGOS AdminUncurated
Microarray
Tools
Transcript Sequence
ATGCGTTGCATGTCTACTCTCACGTTCTTGAGCGCCGCCTTGCTAGTGGCCCAGCCGGCACATGCAGCTGTCGATGGTCTCTGTCCCATCATAGGCGCCGTCTTGCCGCCGCCGGTGAACCCTGGCTCTCACCCAGCAGTGGACAAGGCAATTGCCCACCTCCAATCGTTCCTCGAGACGACAACCAGCAAGCTCAACGTCTCTAGCGTTTCGGTTGCCATCAAATCCATCCACGAGGATAAGAAACTGCTCGATTTCCATTCAACGCCACCAACGCTGGACTCTAGGGGCGTGAAGACTGTCGATGGCAAATCCATCTACCGCGTCGGCAGCATCTCAAAGATTTTCCCCGTTTTGGCTGTCCTGAAACTGGATGGCGTTAGCCTCGACGACAAGATCACAAAATACCTGCCTGAACTCCGAGGCCTTGTTAACCAACAACCCGTTAGAGATTCTTTGACCGAGGTGGAGTGGGACGAAATTACCCTAGGGGCGCTGGGAGCACACATTAGTGGTATCAGCACGGATTCGGTTCGTCCACCAGATTTCTTCAGGGGCTTTGGTGGACGGGCACCGGTTTTCGCCCCCTTCAGCGCCCCGGCGTACTCCAACATTGGCACGCCTCTGTTGGCCCTGGTTGTAGAGAAGGTCTCCAAAATGAGCTACGAGGATTTCTTGACCGAGAGGATCCTTGCACCGCTGGGTCTCAATAGCACGGGCTCCGTCATACCTGAGGAAGCCAAGGGCGTCATACCCAAGGGCGACTTCTGGTTTGGGACAGACACTGGTTTCGAGACGCCAGCTGGTGGACTATACTCGTCCTCGGACGACATGATCGCCTTTGCCGACGCTGTTCTGTCCAACAAAGTCCTCTCACCCGCGCAGACTCGCAAGTGGTTGAAGCCGCTGACCAACACGGCCTCGTTGGGCACACAGCTGGGAGCGCCGTGGGAGATTTTCCGCGCCATCAACGTCACCCGCGACCAGCGCGCCATCGAGGTGATCACCAAGGGCGGAGACCTGTTCAACTACCGCGCCAGCATGGCCCTGGTTCCCGACTATGGCCTGGCCATGACAGTCCTAGTGAGCGGCGACACCGCCGAGATGGGCGCCATCGTGCCTTCCGTCCAGGCGACCGCCGTCGAGATTCTTCTGCCGGCCCTGGAGCGGGAGGGCAAGGACCAGGCGGCAGCGGCGTACGCGGGGAGGTACACCGACGAAGCGACCAACTCGACCATCCTGCTCGAAGTGGACCCGGATCGCGATGATGGACCAGGAATTCGGGGTTCCGAGGTTGTGATACGCGGATTCGACGTGCTGAAAAACTATCCCCTGTACGACAACCTCAACGGCAGGGCCCCCAGCACCATGCCGCTCGTCAGGCTCCGGATGCAGCCGACCGAGGGCCTTTCGACCGGCAAGAGGCAGTCGTGGCGCGGAGTTTGGAATGTCGGCTCGGCGGAGCAGGTTGCAGCGCGCGATGCGGCGTTTCCCTGGGCTGAGAACGGCTGCATCACCTGGGCGAGCACAGATCGGTTGGTATACGGGCTGCAGGCGTTGGATAGATTCATCTTCAACGTCGAGCCCAGAAGCAACGGGATGATCGATGCGCAGAGCCTGGAGTTTCCTGCTTTTCAGGTAAAGCTGGTCCGCCAGAAGGCATGCAAGGTCCGCAGGGGTGGCAGTTAG
Translated Sequence
MRCMSTLTFLSAALLVAQPAHAAVDGLCPIIGAVLPPPVNPGSHPAVDKAIAHLQSFLETTTSKLNVSSVSVAIKSIHEDKKLLDFHSTPPTLDSRGVKTVDGKSIYRVGSISKIFPVLAVLKLDGVSLDDKITKYLPELRGLVNQQPVRDSLTEVEWDEITLGALGAHISGISTDSVRPPDFFRGFGGRAPVFAPFSAPAYSNIGTPLLALVVEKVSKMSYEDFLTERILAPLGLNSTGSVIPEEAKGVIPKGDFWFGTDTGFETPAGGLYSSSDDMIAFADAVLSNKVLSPAQTRKWLKPLTNTASLGTQLGAPWEIFRAINVTRDQRAIEVITKGGDLFNYRASMALVPDYGLAMTVLVSGDTAEMGAIVPSVQATAVEILLPALEREGKDQAAAAYAGRYTDEATNSTILLEVDPDRDDGPGIRGSEVVIRGFDVLKNYPLYDNLNGRAPSTMPLVRLRMQPTEGLSTGKRQSWRGVWNVGSAEQVAARDAAFPWAENGCITWASTDRLVYGLQALDRFIFNVEPRSNGMIDAQSLEFPAFQVKLVRQKACKVRRGGS*

Instructions:
This screen serves to display annotation information for a gene and provide the mechanism for updating such information. Updateable information is denoted by a green label in the left hand column of the table above.
  1. If you would like to add or update the annotation information for a gene, you must first Login to the MGOS system by clicking the 'Login' link in the upper right-hand corner of the screen (if you are not already logged in).
  2. To update the Gene Symbol, Synonyms, Gene Description, Gene Comments, or Secreted Protein status simply click the pencil icon located next to the field to be edited; this will cause a text edit box, a save icon, and a cancel icon to appear in place of the pencil. Enter the new value in the text box and click the save icon (which looks like a diskette) to save your changes.
  3. To change or add transcript, gene ontology, fungal anatomy, publication, or mutant data for a gene you should either click the pencil next to the item to be changed to edit the data, or the 'Add a ...' link for the appropriate section. You will then be redirected to a new screen to add or update the data, which will have additional instructions at the bottom of the screen.